Skip to main content

Table 2 Accession number, primer sequence and product size of genes evaluated

From: Increased maternal consumption of methionine as its hydroxyl analog promoted neonatal intestinal growth without compromising maternal energy homeostasis

Gene (accession number)

Primer sequence (5'–3')

Product size, bp

18S ribosomal RNA (NR_046261.1)

 

114

 Forward

GACTCAACACGGGAAACCTCAC

 

 Reverse

ATCGCTCCACCAACTAAGAACG

 

DNA-binding protein inhibitor ID-2 (NM_001037965.1)

 

121

 Forward

CCAGTGAGGTCCGTTAGGAAAA

 

 Reverse

GCTTGGAGTAGCAGTCGTTCAT

 

IGF-II precursor (NM_213883.2)

 

163

 Forward

CATCGTGGAAGAGTGCTGCT

 

 Reverse

CCAGGTGTCATAGCGGAAGAACT

 

Somatostatin precursor (NM_001009583.1)

 

159

 Forward

CTCTCCATCGTCCTGGCTCT

 

 Reverse

GTTCTCTGTCTGGTTGGGTTCAG

 

Vanin-1 (NM_214133.1)

 

142

 Forward

GGATGCTTGAGAAGAGAGAAGACG

 

 Reverse

ACCGAGTCACCACAGGAGTGTA

 

Ubiquitin carboxyl-terminal hydrolase FAF-g (NM_004654.3)

 

123

 Forward

TGGTCTCCTCCAGTACAAAGCA

 

 Reverse

CTGGTCATCTGGCTCCTCTTCT

 

Adenylate cyclase (NM_001114)

 

87

 Forward

CACACTACTGCCCTTCAGCA

 

 Reverse

ATCAAAGAACCGAGCACCAG

 

N-Acyl-D-glucosamine 2-epimerase (NM_213900.1)

 

91

 Forward

CCTGCCTTACTGCGTCTCTT

 

 Reverse

TCAGGTAGCCAAACCATTCC

 

Carnitine transporter 2 (NM_003060)

 

120

 Forward

GTTCCAAGAAGCAGCAGTCC

 

 Reverse

AAAGCCCAAAATAGCCCACT

 

Oxysterol binding protein-related protein 10 (NM_017784)

 

86

 Forward

CCACCCATCTCCTGCTTCTA

 

 Reverse

CCCATGAACTTGCTTTTGGT

 

Acyl-CoA dehydrogenase (NM_213897.1)

 

94

 Forward

TTGGTGCCATAGCAATGACAGA

 

 Reverse

AACAGCCACTACAATCACAACATCA

 

Aminopeptidase A (NM_214017.1)

 

73

 Forward

TGGAGAACTGGGGACTCATCAC

 

 Reverse

TTAGCCACAAGTCTTCCCACCAT

 

Cathepsin F precursor (TC104654)

 

75

 Forward

AGAGCCGAGATAGCTTCCTGAAA

 

 Reverse

TCCTTCCCATTGGTTCTCACA

 

Leukocyte antigen related protein precursor (NM_130440.2)

 

67

 Forward

GCGAGGGATTCATTGACTTCAT

 

 Reverse

CTCAGAGTGATGAACACCCCG

 

Preprogalanin (NM_214234 · 1)

 

94

 Forward

CAACCACAGATCATTCCACGAC

 

 Reverse

GCAAGAAAGCCAGAAACTCCATT

 

Sodium-and chloride-dependent creatine transporter 1 (NM_001177327.1)

 

77

 Forward

TCGACTACTACTCGGCCAGCG

 

 Reverse

ACCAGCGGGGTGAAGAAAGAC