Skip to main content

Advertisement

Table 2 Accession number, primer sequence and product size of genes evaluated

From: Increased maternal consumption of methionine as its hydroxyl analog promoted neonatal intestinal growth without compromising maternal energy homeostasis

Gene (accession number) Primer sequence (5'–3') Product size, bp
18S ribosomal RNA (NR_046261.1)   114
 Forward GACTCAACACGGGAAACCTCAC  
 Reverse ATCGCTCCACCAACTAAGAACG  
DNA-binding protein inhibitor ID-2 (NM_001037965.1)   121
 Forward CCAGTGAGGTCCGTTAGGAAAA  
 Reverse GCTTGGAGTAGCAGTCGTTCAT  
IGF-II precursor (NM_213883.2)   163
 Forward CATCGTGGAAGAGTGCTGCT  
 Reverse CCAGGTGTCATAGCGGAAGAACT  
Somatostatin precursor (NM_001009583.1)   159
 Forward CTCTCCATCGTCCTGGCTCT  
 Reverse GTTCTCTGTCTGGTTGGGTTCAG  
Vanin-1 (NM_214133.1)   142
 Forward GGATGCTTGAGAAGAGAGAAGACG  
 Reverse ACCGAGTCACCACAGGAGTGTA  
Ubiquitin carboxyl-terminal hydrolase FAF-g (NM_004654.3)   123
 Forward TGGTCTCCTCCAGTACAAAGCA  
 Reverse CTGGTCATCTGGCTCCTCTTCT  
Adenylate cyclase (NM_001114)   87
 Forward CACACTACTGCCCTTCAGCA  
 Reverse ATCAAAGAACCGAGCACCAG  
N-Acyl-D-glucosamine 2-epimerase (NM_213900.1)   91
 Forward CCTGCCTTACTGCGTCTCTT  
 Reverse TCAGGTAGCCAAACCATTCC  
Carnitine transporter 2 (NM_003060)   120
 Forward GTTCCAAGAAGCAGCAGTCC  
 Reverse AAAGCCCAAAATAGCCCACT  
Oxysterol binding protein-related protein 10 (NM_017784)   86
 Forward CCACCCATCTCCTGCTTCTA  
 Reverse CCCATGAACTTGCTTTTGGT  
Acyl-CoA dehydrogenase (NM_213897.1)   94
 Forward TTGGTGCCATAGCAATGACAGA  
 Reverse AACAGCCACTACAATCACAACATCA  
Aminopeptidase A (NM_214017.1)   73
 Forward TGGAGAACTGGGGACTCATCAC  
 Reverse TTAGCCACAAGTCTTCCCACCAT  
Cathepsin F precursor (TC104654)   75
 Forward AGAGCCGAGATAGCTTCCTGAAA  
 Reverse TCCTTCCCATTGGTTCTCACA  
Leukocyte antigen related protein precursor (NM_130440.2)   67
 Forward GCGAGGGATTCATTGACTTCAT  
 Reverse CTCAGAGTGATGAACACCCCG  
Preprogalanin (NM_214234 · 1)   94
 Forward CAACCACAGATCATTCCACGAC  
 Reverse GCAAGAAAGCCAGAAACTCCATT  
Sodium-and chloride-dependent creatine transporter 1 (NM_001177327.1)   77
 Forward TCGACTACTACTCGGCCAGCG  
 Reverse ACCAGCGGGGTGAAGAAAGAC