Skip to main content

Advertisement

Table 2 Oligonucleotide polymerase chain reaction primers

From: Dietary supplementation with a high dose of daidzein enhances the antioxidant capacity in swine muscle but experts pro-oxidant function in liver and fat tissues

Gene Primer sense/antisense Product length, bp
β-actin CCAGGTCATCACCATCGG CCGTGTTGGCGTAGAGGT 158
COX1 TGGCAACTGCTTCTTCCCTTT GTGAGCCGACTGAACACCATCTAT 163
COX2 AGCAGGCTGATACTGATAGGAG TGTTGATAGTTGTACTCGTGGC 224
GR GTGAGCCGACTGAACACCATCTAT CTTCTTCCCGTTGACCTCTACTG 120
GCL AACCAGGCTCTCTGCACAATCACTT TTAGGGTACTGAAACGCGGGTGC 226
NOX2 ACCCTTTCACCCTGACCTCT AATCCCTGCTCCCACTAACA 221
NOX4 TGGAACGCACTACCAGGATG TTCGGCACAATACAGGCACA 202
NOX5 GCCTGGCGACTACTTGTATCTG CTTCCTCTGACTCCTTCTCATTTTC 226
5-LOX GCCAGTGGTTTGCGGGCA GCTTCTCGATTTTGATGAGCTGGA 183
P450 8B1 AAGGATGCGAAGAGAAAACTAGACT 122
AGGTGCTTGGTGCTGGCTGA