Skip to main content

Advertisement

Table 2 Oligonucleotide polymerase chain reaction primers

From: Dietary supplementation with a high dose of daidzein enhances the antioxidant capacity in swine muscle but experts pro-oxidant function in liver and fat tissues

Gene Primer sense/antisense Product length, bp
β-actin CCAGGTCATCACCATCGG
CCGTGTTGGCGTAGAGGT
158
COX1 TGGCAACTGCTTCTTCCCTTT
GTGAGCCGACTGAACACCATCTAT
163
COX2 AGCAGGCTGATACTGATAGGAG
TGTTGATAGTTGTACTCGTGGC
224
GR GTGAGCCGACTGAACACCATCTAT
CTTCTTCCCGTTGACCTCTACTG
120
GCL AACCAGGCTCTCTGCACAATCACTT
TTAGGGTACTGAAACGCGGGTGC
226
NOX2 ACCCTTTCACCCTGACCTCT
AATCCCTGCTCCCACTAACA
221
NOX4 TGGAACGCACTACCAGGATG
TTCGGCACAATACAGGCACA
202
NOX5 GCCTGGCGACTACTTGTATCTG
CTTCCTCTGACTCCTTCTCATTTTC
226
5-LOX GCCAGTGGTTTGCGGGCA
GCTTCTCGATTTTGATGAGCTGGA
183
P450 8B1 AAGGATGCGAAGAGAAAACTAGACT 122
AGGTGCTTGGTGCTGGCTGA