Skip to main content

Advertisement

Table 1 Primer sequences used for the RT-qPCR analysis

From: 1,25-Dihydroxyvitamin D3 modulates calcium transport in goat mammary epithelial cells in a dose- and energy-dependent manner

Genes Strand Sequences (5′-3′) Source
β-actin Forward CCTGCGGCATTCACGAAACTAC JX046106.1
Reverse ACAGCACCGTGTTGGCGTAGAG
Calbindin-D 9 k Forward TCTCCAGAAGAACTGAAGGGC XM_005701057.2
Reverse CCAACACCTGGAATTCTTCG
GLUT1 Forward GCTAGCATGGAGCCCACCAGCAAG JQ343217.1
Reverse AAGCTTTCACACTTGGGAATCAGCTCC  
GLUT12 Forward GGAAAAGTGACCGCTCGTG JQ798185.1
Reverse TGTCCTGGTAGGCAAAGAACTG
VDR Forward GCACTTCCTTACCTGACCCC [25]
Reverse CCGCTTGAGGATCATCTCCC
PMCA1b Forward GAGACCATGGCTTGCTGAGT [26]
Reverse GACCTTCTGGTACTGCCACC
PMCA2b Forward GCATTTTCATCGGGTTAGGAG [27]
Reverse AGAGCTACGAAACGCCTTCAC
Orai1 Forward CAGCGTGCATAATATACCTAACTCTACCCG [28]
Reverse GTATTGATGAGGAGAGCAAGCGTGAAT