Skip to main content

Table 1 Primers for real-time quantitative PCR

From: High-concentrate feeding upregulates the expression of inflammation-related genes in the ruminal epithelium of dairy cattle

Gene Name Gene ID Primer sequence (5′ → 3′) Amplicon Size,bp Reference
IL-1β NM_174093.1 For: AACCGAGAAGTGGTGTTCTGC 167 [18]
   R: TTGGGGTAGACTTTGGGGTCT   
IL-2 NM_180997.2 For: ACATTTGACTTTTACGCGCCCAAG 307 [19]
   R: AATGAGAGGCACTTAGTGATC   
IL-6 NM_000600.3 For: GGAGGAAAAGGACGGATGCT 227 [18]
   R: GGTCAGTGTTTGTGGCTGGA   
IL-8 NM_173925 For: CCTCTTGTTCAATATGACTTCCA 170 [18]
   R: GGCCCACTCTCAATAACTCTC   
IL-12β U11815 For: AGGTCGTGGTAGAAGCTGTG 276 [20]
   R: CCTTGTGGCATGTGACTTTG   
TNF-α NM_173966.2 For: CTTCTGCCTGCTGCACTTCG 156 [18]
   R: GAGTTGATGTCGGCTACAACG   
GAPDH NM001034034 For: GGGTCATCATCTCTGCACCT 176 [21]
   R: GGTCATAAGTCCCTCCACGA