Skip to main content

Table 1 Forwards (F) and reverse (R) primers of genes for RT-qPCR analysis

From: Effect of in ovo folic acid injection on hepatic IGF2 expression and embryo growth of broilers

Genes Accession number Primer sequences, 5′to3′ Product size, bp
β-actin L08165 F: ATTGTCCACCGCAAATGCTTC 113
   R: AAATAAAGCCATGCCAATCTCGTC  
IGF2 NM001030342 F: AGACCAGTGGGACGAAATAACA 131
   R: CACGCTCTGACTTGACGGAC  
DNMT1 NM206952 F: ACAGCCTTCGCCGATTACA 248
   R: CTCTCCACCTGCTCCACCAC  
HAT1 NM204207 F: AGAAGTTTGACTGTGTGGAGGC 152
   R: AGAATATGTGTGCAGCAGCATT