Skip to main content

Advertisement

Table 2 Primes for real time PCR

From: Effects of benzoic acid (VevoVitall®) on the performance and jejunal digestive physiology in young pigs

Target gene Forward primer 5’-3’ Reverse primer 5’-3’ Accession number
GLP-2 TGTAATGCTGGTACAAGGCAG CTTGTCTTCAGTCATCTGATC NM_214324.1
β-actin TCTGGCACCACACCTTCT TGATCTGGGTCATCTTCTCAC DQ178122