Skip to main content

Table 2 Primers and probes used for genotyping

From: Porcine methionine sulfoxide reductase B3: molecular cloning, tissue-specific expression profiles, and polymorphisms associated with ear size in Sus scrofa

Polymorphism Primer/probe Sequence
c.-735C > T M105F 5’ACGTTGGATGTATATGGAGTTGAGGCACGC3’
M105R 5’ACGTTGGATGGGTGAAAAGAACGACTGACC3’
Probe105 5’CTGACCTAGATAAAACATCAG3’
c.2571 T > C M113F 5’ACGTTGGATGAGCCTGAGGTGAAACATCTG3’
M113R 5’ACGTTGGATGACTCGTCATTGTCACATGGG3’
Probe113 5’ACATTGTGCTCTTCCTCT3’