Skip to main content

Table 1 Primers for PCR amplifications of porcine MSRB3

From: Porcine methionine sulfoxide reductase B3: molecular cloning, tissue-specific expression profiles, and polymorphisms associated with ear size in Sus scrofa

Primer Purpose Primer Primer sequence (5’-3’) Product size ,bp Annealing T,°C
Part fragment cloning M1F ACCAGCCACTCAACTACTGC 1152 61
  M1R ACTTCCACCAGCAGAGCTTC   
  M2F TGGTTCTAATTGCCTCAAAGG 774 59
  M2R GCAATGTCAGGACACCCTC   
  M3F AGCATCCAGACTATCCCAGAAG 619 59
  M3R TACACCTCGCCATATTGACTCA   
3’-RACE 3 F1 GGGGTGGACAAGGAAGATAA - 55
  3 F2 AAAAGCTCCTCTTCTAATGC - 55
5’-RACE 5R1 CTTTGAGGCAATTAGAACCAG - 60
  5R2 TACAGTTGCCTTACATTCC - 60
  5R3 CATAAAACTGCCCTCCTACT - -
  5R4 CACAGGCTCGCAGGGCTACT - -
qRT-PCR M4F (target) CCTCAGGGTCATGTAGGGATAAA 155 60
  M4R (target) TCCAGGATCTTTGTGATGTGTATATTC   60
  G1F (control) AGGGCATCCTGGGCTACACT 166 60
  G1R (control) TCCACCACCCTGTTGCTGTAG   60
Polymorphism discovery for exons M345F (exon 1) CCGTGCCCAGGAATT 345 54
  M345R (exon1) CGGCTCAGGAAAGAGG   
  M278F (exon 2) GTGTTCAGTTCCAGATAAAACC 278 53
  M278R (exon 2) ACCCCAGACCAGTGCC   
  M314F (exon 3) GGGACTGGTCTGGTCATT 314 56
  M314R (exon 3) CGGATTCAGCGGTTGG   
  M308F (exon 4) GCCCTTGAAAGATTTATTGG 308 52
  M308R (exon 4) CCGGGGAGGAACAGAA   
  M190F (exon 5) TTCCCTTTGCAGGTCAG 190 59
  M190R (exon 5) CATAGCCCTGCTTTGAGA   
  M272F (exon 6) GTATCTCCTCTGTTTTGGTTC 272 59
  M272R (exon 6) TCATTGTGCTTGTCTGTCC   
  M618F (exon 7) CGTGGTTTCCATCGTTC 618 52
  M618R (exon 7) CAAGCACCTTCTGCCTC   
  M2F (exon 7) TGGTTCTAATTGCCTCAAAGG 774 59
  M2R (exon 7) GCAATGTCAGGACACCCTC   
  M3F (exon 7) AGCATCCAGACTATCCCAGAAG 619 59
  M3R (exon 7) TACACCTCGCCATATTGACTCA   
  M839F (exon 7) GCTCCTCTTCTAATGCTTACT 839 54
  M839R (exon 7) GCAGCCTATGGCAAACT   
Polymorphism discovery for promoter M175F GGCTTTGGAATGAGGTTT 175 53
  M175R TTAGACGCTGTGCTAGTTGT   
  M692F AAACAACTAGCACAGCGTC 692 50
  M692R GCCCAAATGCCAAAA   
  M694F TTTCAGATACCCAGCATTG 694 50
  M694R GCCTGAAGGGGAGTGTTA   
  M754F CCCATTACTGTGAGGAAAA 754 53
  M754R AAAGCAGAGCCGAGCA   
  M423F TGGCTCGCTGTCGGA 423 58
  M423R GGCGGGCTCATGGAA