Skip to main content

Advertisement

Table 1 Primers used for mutation detecting, cloning and expression survey

From: Effects of SNPs and alternative splicing within HGF gene on its expression patterns in Qinchuan cattle

Primer Sequences (5′–3′) Size, bp Tm, °C
P-BglII F: TTTACCAATAGCCCACAG 229 53
R: CATTCTGCCTACTGAAATG
P-HGF-CDS F: TCTGAGTCGGAAGAGGGT 2, 250 54
R: ATAAGGCACCACAGTTGTAG
P-Q-HGF F: ACCAATGTGCCAATAGATG 229 60
R: TTAGTGATAGATACCGTCCC
P-qHGF-W F: GTATCATTGGTAAAGGCGGTAG 119 60
R: ATAGCTCGAAGGCAAAAAG
P-qHGF-M F: GTATCATTGGTAAAGGCGGTAG 109 60
R: CCCCGATAGCTGTGTTCG
P-Q-GAPDH F: TGTTTGTGATGGGCGTGAACCA 154 60
R: ATGGCGTGGACAGTGGTCATAA
P-HGF-AS F: TTGGTAAAGGCGGTAGCT 205/190 58
R: TAGCGTACCTCTGGATTGCT