Skip to main content

Advertisement

Table 2 Specific primers used in this study

From: An efficient strategy for generation of transgenic mice by lentiviral transduction of male germline stem cells in vivo

Name of oligonucleotide Sequence
eGFP Forward GACGTAAACGGCCACAAGTT
eGFP Reverse TCTTGTAGTTGCCGTCGTCC
GAPDH Forward CTCTCTGCTCCTCCCTGTTCC
GAPDH Reverse CCAAATCCGTTCACACCGACC
BSP CMV Forward TAAAAATAAATTATAAAAATTTAAAATTTT
BSP CMV Reverse AATACCAAAACAAACTCCCATTAAC
BSP EF-1 Forward TGTTTGATTTTGTTTGTTTAATTTTA
BSP EF-1 Reverse ACCCTACTTAAAAATACCCTCTCC