Skip to main content

Advertisement

Table 2 Primers for qPCR assay

From: Effect of supplementation of allicin on methanogenesis and ruminal microbial flora in Dorper crossbred ewes

Target species Primer sequence (5’→3’)a Amplicon
Total bacteria F: CGGTGAATACGTTCYCGG 123
R: GGWTACCTTGTTACGACTT
Methanogens F: TTCGGTGGATCDCARAGRGC 140
R: GBARGTCGWAWCCGTAGAATCC
Protozoans F: GCTTTCGWTGGTAGTGTATT 223
R: CTTGCCCTCYAATCGTWCT
F. succinogenes F: GTTCGGAATTACTGGGCGTAAA 121
R: CGCCTGCCCCTGAACTATC
R. flavefaciens F: GATGCCGCGTGGAGGAAGAAG 286
R: CATTTCACCGCTACACCAGGAA
R. albus F: GTTTTAGGATTGTAAACCTCTGTCTT 270
R: CCTAATATCTACGCATTTCACCGC
B. fibrisolvens F: TAACATGAGAGTTTGATCCTGGCTC 135
R: CGTTACTCACCCGTCCGC
  1. aPrimers were designed according to Denman and McSweeney [22]