Skip to main content

Advertisement

Table 2 16s rDNA real-time PCR primers used to quantify intestinal bacteria

From: In vitro antibacterial activity of thymol and carvacrol and their effects on broiler chickens challenged with Clostridium perfringens

Target Primer sequence (5′–3′) a Amplicon size (bp) Reference
Total bacteria F:ACTCCTACGGGAGGCAGCAGT 200 [19]
R:GTATTACCGCGGCTGCTGGCAC
Lactobacillus subgroup F:AGCAGTAGGGAATCTTCCA 341 [19]
R:CACCGCTACACATGGAG
Escherichia subgroup b F:GTTAATACCTTTGCTCATTGA 340 [20]
R:ACCAGGGTATCTAATCCTGT
Clostridium perfringens F:AAAGATGGCATCATCATTCAAC 279 [21]
R:TACCGTCATTATCTTCCCCAAA
  1. a F means forward, R means reverse
  2. b The targeted Escherichia subgroup contained genera of E. coli, Hafnia alvei and Shigella