Skip to main content

Advertisement

Table 1 Primers used for gene cloning and expression analysis

From: Molecular cloning and expression patterns of the cholesterol side chain cleavage enzyme (CYP11A1) gene during the reproductive cycle in goose (Anas cygnoides)

Primer name Oligo sequences (5′–3′) Type
cCYPF GTCTGTGTGCCATGTGCTGTACGG Complete ORF
cCYPR GTTTGTCGGGGAGGAGGATGAGGT
5′Router GAACTTGCGGGCCATGATGT 5′RACE
5′Rinner CCCGCAGCCGGACGACC
3′Router CAAGCACTTCAAGGGGCTGAGCTT 3′RACE
3′Rinner GACCAAGCGGGCAGTGGAAGTTGGGACCA
eCYP-F TGCTGCAGGACTTTGTGG Expression profile
eCYP-R TGGAGAGGATGCCCATGT
GAPDH-F GGTGGTGCTAAGCGTGTCAT Expression profile
GAPDH-R CCCTCCACAATGCCAAAGTT