Skip to main content

Table 2 Primers used for real-time PCR

From: Partially replacing cornstarch in a high-concentrate diet with sucrose inhibited the ruminal trans-10 biohydrogenation pathway in vitro by changing populations of specific bacteria

Target species Primer Sequence (5′ → 3′) Reference
General bacteria Forward CGGCAACGAGCGCAACCC McSweeney and Denman [41]
  Reverse CCATTGTAGCACGTGTGTAGCC
Butyrivibrio fibrisolvens Forward ACCGCATAAGCGCACGGA Stevenson and Weimer [42]
  Reverse CGGGTCCATCTTGTACCGATAAAT
Streptococcus bovis Forward TTCCTAGAGATAGGAAGTTTCTTCGG Stevenson and Weimer [42]
  Reverse ATGATGGCAACTAACAATAGGGGT
Megasphaera elsdenii Forward AGATGGGGACAACAGCTGGA Stevenson and Weimer [42]
  Reverse CGAAAGCTCCGAAGAGCCT
Propionibacterium acnes Forward GGGTTGTAAACCGCTTTCGCCTG Shingfield et al. [43]
  Reverse TGCTTTCGATACGGGTTGAC