Skip to main content

Advertisement

Table 1 Primers utilized for quantitative real-time PCR analysis

From: Factors controlling nutrient availability to the developing fetus in ruminants

Target 1 Forward/revers primers, (5’→3’) 2 Length of amplicon, bp GenBank accession No 3
SLC7A1 CCTAGCGCTCCTGGTCATCA 56 AF212146
  GGGCGTCCTTGCCAAGTA   
SLC7A2 GCAGAGCAGCGCTGTCTTT 62 XM_002698665
  ACTGTCCAGAGTGACGATTTTCC   
SLC7A5 GGTGAACCCTGGTACGAATTTAGT 64 NM_174613
  TCCACGCTCGAGAGGTATCTG   
SLC7A6 CATTTGTGAACTGCGCCTATGT 72 NM_001075937
  CCAGGACCTTGGCATAAGTGA   
SLC7A7 TCAGGCTTGCCCTTCTACTTCT 64 NM_001075151
  GGAGCCAAAGAGGTCGTTTG   
SLC7A8 GGCCATGATCCACGTGAAG 65 NM_001192889
  GGGTGGAGATGCATGTGAAGA   
SLC38A2 CAGCTATAGTTCCAACAGCGACTTC 77 NM_001082424
  CATCGGCATAATGGCTTTTCA   
SLC38A4 TGCTTCATGCTTACAGCAAAGTG 63 NM_001205943
  CAGCCAGGCGTACCATGAG   
  1. 1The amplification target.
  2. 2The forward and reverse DNA oligos used in the amplification of the target. Forward and reverse primers do not necessarily indicate the in vivo direction of transcription.
  3. 3The accession number to the ovine or bovine sequence that was used during primer design.