Skip to main content

Table 1 PCR primers used for SYBR green qRT-PCR analysis

From: Quantitative analysis of ruminal methanogenic microbial populations in beef cattle divergent in phenotypic residual feed intake (RFI) offered contrasting diets

Target Taxon Primer1 E2 Product size, bp Reference
Forward Reverse
16 s V33 CCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG 2.00 194 Muyzer et al., 1993 [18]
Total methanogens GGATTAGATACCCSGGTAGT GTTGARTCCAATTAAACCGCA 1.96 173 Hook et al., 2009 [16]
Methanosphaera stadtmanae CTTAACTATAAGAATTGCTGGAG TTCGTTACTCACCGTCAAGATC 2.01 150 Zhou et al., 2009 [17]
  1. 15’→3’.
  2. 2Efficiency.
  3. 3Primers used for qRT-PCR normalisation.