Skip to main content

Advertisement

Table 2 Primers used in real-time PCR for the detection of rumen microorganism

From: Effect of Saccharomyces cerevisiae on alfalfa nutrient degradation characteristics and rumen microbial populations of steers fed diets with different concentrate-to-forage ratios

Target bacterium Primer sequence (5'-3') References
Total bacteria F, CGGCAACGAGCGCAACCC [15]
R, CCATTGTAGCACGTGTGTAGCC
Rumen fungi F, GAGGAAGTAAAAGTCGTAACAAGGTTTC [16]
R, CAAATTCACAAAGGGTAGGATGATT
Protozoa F, GCTTTCGWTGGTAGTGTATT [16]
R, CTTGCCCTCYAATCGTWCT
Ruminobacter ablus F, TGTTAACAGAGGGAAGCAAAGCA [17]
R, TGCAGCCTACAATCCGAACTAA
Ruminococcus flavefaciens F, TGGCGGACGGGTGAGTAA [17]
R, TTACCATCCGTTTCCAGAAGCT
Butyrivibrio fibrisolvens F, ACCGCATAAGCGCACGGA [17]
R, CGGGTCCATCTTGTACCGATAAAT
Fibrobacter succinogenes F, GCGGGTAGCAAACAGGATTAGA [17],[18]
R, CCCCCGGACACCCAGTAT
Selenomonas ruminantium F, CAATAAGCATTCCGCCTGGG [17],[18]
R, TTCACTCAATGTCAAGCCCTGG
Streptococcus bovis F, CTAATACCGCATAACAGCAT [19]
R, AGAAACTTCCTATCTCTAGG
Ruminobacter amylophilus F, CAACCAGTCGCATTCAGA [19]
R, CACTACTCATGGCAACAT
Lactobacillus F, AGCAGTAGGGAATCTTCCA [20]
  R, CGCCACTGGTGTTCYTCCATATA