Skip to main content

Advertisement

Table 1 Primer sequences used in real-time PCR

From: Evaluation of steroidogenic capacity after follicle stimulating hormone stimulation in bovine granulosa cells of Revalor 200® implanted heifers

   Sequences of primers (5′-3′)
Gene Accession no. Forward Reverse
1 3β-HSD NM_174343 CCACACCAAAGCTACGATGA GCAAGCCAGTACTGCAGAGA
2 CYP11A1 NM_176644 AAGTTTGACCCAACCAGGTG GTGGATGAGGAAGAGGGTCA
3 CYP19A1 NM_174305 CAACAGCAGAGAAGCTGGAAGACA CACCCACAACAGTCTGGATTTCCCT
4 GAPDH NM_001034034 GGGTCATCATCTCTGCACCT GGTCATAAGTCCCTCCACGA
5 MRPL19 NM_001046068 GGAAAGCAGGTTCTTGAGTCC TGGCATATGGGTCAGCAGTA
6 PPIA XM_002690515 GGTACTGGTGGCAAGTCCAT GCCATCCAACCACTCAGTCT
7 STAR BC110213 CCCATGGAGAGGCTTTATGA CGTGAGTGATGACCGTGTCT
  1. 13β-HSD = 3β-hydroxysteroid dehydrogenase.
  2. 2CYP11A1 = P450 side chain cleavage.
  3. 3CYP19A1 = aromatase.
  4. 4GAPDH = glyceraldehyde-3-phosphate dehydrogenase.
  5. 5MRPL19 = mitochondrial ribosomal protein L19.
  6. 6PPIA = cyclophilin A.
  7. 7STAR = steroidogenic acute regulatory protein.