Skip to main content

Table 1 A list of the Salmonella primers used in this study

From: Deletions in the pyruvate pathway of Salmonella Typhimurium alter SPI1-mediated gene expression and infectivity

Gene

Forward sequence (5-3)

Reverse sequence (5-3)

Locus or reference

Technique

pflB

GAAGGTAGGTGTTACATGTCCGAGCTT AATGAAAAGTTAGCCACAGTGCAGGCT GGAGCTGCTTC

TTTCAGTCAAACCCATTACAT GGTCTGCGTGAAGGTACGAGT AATCATATGAATATCCTCCTTAG

STM0973

Lambda red

adhE

TATCAGGAGAGCATTATGGCTGTTACT AATGTCGCTGAACTTAACGTGCAGGCT GGAGCTGCTTC

AAAACAGATAACGAATTAAGC GGATTTTTTCGCTTTTTTCTC TGCCATATGAATATCCTCCTTAG

STM1749

16S rRNA

AGGCCTTCGGGTTGTAAAGT

GTTAGCCGGTGCTTCTTCTG

[49]

qPCR

hilA

ATAGCAAACTCCCGACGATG

ATTAAGGCGACAGAGCTGG

[50]

hilC

CTCACCTCTTCAGCGGCCAGT

CACCCGCAAATGGTCACAGGCT

STM2867

hilD

GGTAGTTAACGTGACGCTTG

GATCTTCTGCGCTTTCTCTG

[50]

invC

TCGGTCGATCGCTGCAA

CCCTGGTCGCGAAAATATTC

STM2894

invE

CGAATGACGCCAGCTGTTC

TGCGTCAGGCGTCGTAAA

STM2897

invF

TGAAAGCCGACACAATGAAAAT

GCCTGCTCGCAAAAAAGC

STM2899

invH

GGTGCCCCTCCCTTCCT

TGCGTTGGCCAGTTGCT

STM2900

invJ

CGCCGCCGGTTAATTG

GCTTCCGCTGCAACCAA

STM2892

orgA

AGGCAGGGAGCCTTGCTT

CCCTGATGCATTGCCAAAA

STM2870

orgB

ACCATCCCGAAACGCTTTTA

TTGCCCCTCAGGCTTATCG

STM2869

prgH

TGAACGGCTGTGAGTTTCCA

GCGCATCACTCTGACCTACCA

STM2874

prgJ

GGTCTATGGAAACGGACATTGTC

CGCCGAACCAGAAAAAGC

STM2872

prgK

GGGTGGAAATAGCGCAGATG

TCAGCTCGCGGAGACGATA

STM2871

rtsA

ACCCGTGGTGAGCTTGATGAGT

CCTGTCCAGGTGGGGAGCAT

SEE_03946

sicA

GATGAGTCTCTGCGGGCAAA

GCTCTGTCTCCGCCGTTTT

STM2886

sicP

AGATGATATCTGGTTATTGAACGGTATG

CTGCCGCCAGATAGAATCG

STM2879

sipA

CGTCTTCGCCTCAGGAGAAT

TGCCGGGCTCTTTCGTT

STM2882

sipB

GGCGCGCTGCTAACCAT

TCGCCCCACCGGTAAAA

STM2885

sipC

ATCAGGCTGGTCGATTTACG

GTACGCCGCTACTCAGGAAC

[50]