Skip to main content

Advertisement

Table 1 A list of the Salmonella primers used in this study

From: Deletions in the pyruvate pathway of Salmonella Typhimurium alter SPI1-mediated gene expression and infectivity

Gene Forward sequence (5-3) Reverse sequence (5-3) Locus or reference Technique
pflB GAAGGTAGGTGTTACATGTCCGAGCTT AATGAAAAGTTAGCCACAGTGCAGGCT GGAGCTGCTTC TTTCAGTCAAACCCATTACAT GGTCTGCGTGAAGGTACGAGT AATCATATGAATATCCTCCTTAG STM0973 Lambda red
adhE TATCAGGAGAGCATTATGGCTGTTACT AATGTCGCTGAACTTAACGTGCAGGCT GGAGCTGCTTC AAAACAGATAACGAATTAAGC GGATTTTTTCGCTTTTTTCTC TGCCATATGAATATCCTCCTTAG STM1749
16S rRNA AGGCCTTCGGGTTGTAAAGT GTTAGCCGGTGCTTCTTCTG [49] qPCR
hilA ATAGCAAACTCCCGACGATG ATTAAGGCGACAGAGCTGG [50]
hilC CTCACCTCTTCAGCGGCCAGT CACCCGCAAATGGTCACAGGCT STM2867
hilD GGTAGTTAACGTGACGCTTG GATCTTCTGCGCTTTCTCTG [50]
invC TCGGTCGATCGCTGCAA CCCTGGTCGCGAAAATATTC STM2894
invE CGAATGACGCCAGCTGTTC TGCGTCAGGCGTCGTAAA STM2897
invF TGAAAGCCGACACAATGAAAAT GCCTGCTCGCAAAAAAGC STM2899
invH GGTGCCCCTCCCTTCCT TGCGTTGGCCAGTTGCT STM2900
invJ CGCCGCCGGTTAATTG GCTTCCGCTGCAACCAA STM2892
orgA AGGCAGGGAGCCTTGCTT CCCTGATGCATTGCCAAAA STM2870
orgB ACCATCCCGAAACGCTTTTA TTGCCCCTCAGGCTTATCG STM2869
prgH TGAACGGCTGTGAGTTTCCA GCGCATCACTCTGACCTACCA STM2874
prgJ GGTCTATGGAAACGGACATTGTC CGCCGAACCAGAAAAAGC STM2872
prgK GGGTGGAAATAGCGCAGATG TCAGCTCGCGGAGACGATA STM2871
rtsA ACCCGTGGTGAGCTTGATGAGT CCTGTCCAGGTGGGGAGCAT SEE_03946
sicA GATGAGTCTCTGCGGGCAAA GCTCTGTCTCCGCCGTTTT STM2886
sicP AGATGATATCTGGTTATTGAACGGTATG CTGCCGCCAGATAGAATCG STM2879
sipA CGTCTTCGCCTCAGGAGAAT TGCCGGGCTCTTTCGTT STM2882
sipB GGCGCGCTGCTAACCAT TCGCCCCACCGGTAAAA STM2885
sipC ATCAGGCTGGTCGATTTACG GTACGCCGCTACTCAGGAAC [50]