Skip to main content

Table 2 Oligonucleotide PCR primers used for the determination of vitamin D receptor protein and sodium phosphate type-IIb mRNA expression

From: Effect of dietary nonphytate phosphorus on laying performance and small intestinal epithelial phosphate transporter expression in Dwarf pink-shell laying hens

Gene GenBank accession Orientation Primer sequence (5′ → 3′) Predicted size, bp
Sodium Phosphate type-IIb NM_204474.1 Forward CTTTTACTTGGCTGGCTGGAT 148
Reverse AGGGTGAGGGGATAAGAACG
Calbindin NM_205513.1 Forward AATCTGCGTTGCTTCCATACA 218
Reverse CATTTAGTTGCCTGAGTTCACCT
Vitamin D receptor NM_205098.1 Forward GGCTCAGGTTTTGCAGATTTG 100
Reverse CAGCATCGCCTTTCCCATT
β-actin NM_205518.1 Forward AACACCCACACCCCTGTGAT 100
Reverse TGAGTCAAGCGCCAAAAGAA