Skip to main content

Advertisement

Table 1 Oligo sequences and accession numbers

From: Fibroblast growth factor receptor 3 effects on proliferation and telomerase activity in sheep growth plate chondrocytes

  Sequence (5’ to 3’) Strand Accession
siRNA oligos    
FGFR3 CAGGUGUCCUUGGAGUCCAGUUCAU Sense AY737276
  AUGAACUGGACUCCAAGGACACCUG Anti-sense  
FGFR2 GGGAAUAUACGUGCUUGGCGGGUAA Sense AJ320477
  UUACCCGCCAAGCACGUAUAUUCCC Anti-sense  
Scrambled control (ScR) CAGUGCCUUGGGACUACUGUUGCAU Sense Invitrogen
  AUGCAACAGUAGUCCCAAGGCACUG Anti-sense  
Real-Time PCR primers    
FGFR3 CGCAGGACACCAGGTCTTTG Forward NM 174318.3
  cggcTACTCCTTCGACACCTGCG Reverse  
TERT CGCTCCTTCCTGCTCTGCTC Forward NM 001046242.1
  cggacGATGGTTTCCACGAGTGTC Reverse  
TR GCAGACTGGATGGTGGATGG Forward NR 001576.1
  cggtaCGCTGTGCTTTTGGTTACG Reverse  
Kanamycin resistance - Exogenous Standard AAGCCCACTGCAAGCTACCTG Forward Invitrogen PCRIII vector based amplicon
  CGTTTTGGCTATCTGGACAAGGGAAA Reverse