Skip to main content

Table 1 Oligo sequences and accession numbers

From: Fibroblast growth factor receptor 3 effects on proliferation and telomerase activity in sheep growth plate chondrocytes

  Sequence (5’ to 3’) Strand Accession
siRNA oligos    
Scrambled control (ScR) CAGUGCCUUGGGACUACUGUUGCAU Sense Invitrogen
Real-Time PCR primers    
Kanamycin resistance - Exogenous Standard AAGCCCACTGCAAGCTACCTG Forward Invitrogen PCRIII vector based amplicon