Skip to main content

Table 13 Microsatellite primer sequences that were used and their base lengths

From: Morphological and microsatellite DNA diversity of Nigerian indigenous sheep

  Name Sequence Base length Annealing temperature (°C) Allele range (bp) Dye
1 OarFCB193 TTCATCTCAGACTGGGATTCAGAAAGGC 28 54 96-136 6FAM
   GCTTGGAAATAACCCTCCTGCATCCC 26    
2 OarJMP29 GTA TAC ACG TGG ACA CCG CTT TGT AC 26 56 96-150 NED
   GAA GTG GCA AGA TTC AGA GGG GAA G 25    
3 OarJMP58 GAAGTCATTGAGGGGTCGCTAACC 24 58 145-169 6FAM
   CTTCATGTTCACAGGACTTTCTCTG 25    
4 OarFCB304 CCCTAGGAGCTTTCAATAAAGAATCGG 27 56 150-188 6FAM
   CGCTGCTGTCAACTGGGTCAGGG 23    
5 OarAE129 AATCCAGTGTGTGAAAGACTAATCCAG 27 54 133-159 6FAM
   GTAGATCAAGATATAGAATATTTTTCAACACC 32    
6 BM8125 CTCTATCTGTGGAAAAGGTGGG 22 50 110-130 VIC
   GGGGGTTAGACTTCAACATACG 22    
7 OarFCB128 ATTAAAGCATCTTCTCTTTATTTCCTCGC 29 55 96-130 VIC
   CAGCTGAGCAACTAAGACATACATGCG 27    
8 OarCP34 GCTGAACAATGTGATATGTTCAGG 24 50 112-130 VIC
   GGGACAATACTGTCTTAGATGCTGC 25    
9 OarVH72 GGCCTCTCAAGGGGCAAGAGCAGG 24 57 121-145 VIC
   CTCTAGAGGATCTGGAATGCAAAGCTC 27    
10 OarHH47 TTTATTGACAAACTCTCTTCCTAACTCCACC 31 58 130-152 VIC
   GTAGTTATTTAAAAAAATATCATACCTCTTAAGG 34    
11 DYMS1 AACAACATCAAACAGTAAGAG 21 59 159-211 NED
   CATAGTAACAGATCTTCCTACA 22    
12 SRCRSP1 TGC AAG AAG TTT TTC CAG AGC 21 54 116-148 NED
   ACC CTG GTT TCA CAA AAG G 19    
13 SRCRSP5 GGA CTC TAC CAA CTG AGC TAC AAG 24 56 126-158 NED
   GTT TCT TTG AAA TGA AGC TAA AGC AAT GC 29    
14 SRCRSP9 AGA GGA TCT GGA AAT GGA ATC 21 55 99-135 6FAM
   GCA CTC TTT TCA GCC CTA ATG 21    
15 MCM140 GTT CGT ACT TCT GGG TAC TGG TCT C 25 60 167-193 NED
   GTC CAT GGA TTT GCA GAG TCA G 22