Skip to main content

Table 13 Microsatellite primer sequences that were used and their base lengths

From: Morphological and microsatellite DNA diversity of Nigerian indigenous sheep

 

Name

Sequence

Base length

Annealing temperature (°C)

Allele range (bp)

Dye

1

OarFCB193

TTCATCTCAGACTGGGATTCAGAAAGGC

28

54

96-136

6FAM

  

GCTTGGAAATAACCCTCCTGCATCCC

26

   

2

OarJMP29

GTA TAC ACG TGG ACA CCG CTT TGT AC

26

56

96-150

NED

  

GAA GTG GCA AGA TTC AGA GGG GAA G

25

   

3

OarJMP58

GAAGTCATTGAGGGGTCGCTAACC

24

58

145-169

6FAM

  

CTTCATGTTCACAGGACTTTCTCTG

25

   

4

OarFCB304

CCCTAGGAGCTTTCAATAAAGAATCGG

27

56

150-188

6FAM

  

CGCTGCTGTCAACTGGGTCAGGG

23

   

5

OarAE129

AATCCAGTGTGTGAAAGACTAATCCAG

27

54

133-159

6FAM

  

GTAGATCAAGATATAGAATATTTTTCAACACC

32

   

6

BM8125

CTCTATCTGTGGAAAAGGTGGG

22

50

110-130

VIC

  

GGGGGTTAGACTTCAACATACG

22

   

7

OarFCB128

ATTAAAGCATCTTCTCTTTATTTCCTCGC

29

55

96-130

VIC

  

CAGCTGAGCAACTAAGACATACATGCG

27

   

8

OarCP34

GCTGAACAATGTGATATGTTCAGG

24

50

112-130

VIC

  

GGGACAATACTGTCTTAGATGCTGC

25

   

9

OarVH72

GGCCTCTCAAGGGGCAAGAGCAGG

24

57

121-145

VIC

  

CTCTAGAGGATCTGGAATGCAAAGCTC

27

   

10

OarHH47

TTTATTGACAAACTCTCTTCCTAACTCCACC

31

58

130-152

VIC

  

GTAGTTATTTAAAAAAATATCATACCTCTTAAGG

34

   

11

DYMS1

AACAACATCAAACAGTAAGAG

21

59

159-211

NED

  

CATAGTAACAGATCTTCCTACA

22

   

12

SRCRSP1

TGC AAG AAG TTT TTC CAG AGC

21

54

116-148

NED

  

ACC CTG GTT TCA CAA AAG G

19

   

13

SRCRSP5

GGA CTC TAC CAA CTG AGC TAC AAG

24

56

126-158

NED

  

GTT TCT TTG AAA TGA AGC TAA AGC AAT GC

29

   

14

SRCRSP9

AGA GGA TCT GGA AAT GGA ATC

21

55

99-135

6FAM

  

GCA CTC TTT TCA GCC CTA ATG

21

   

15

MCM140

GTT CGT ACT TCT GGG TAC TGG TCT C

25

60

167-193

NED

  

GTC CAT GGA TTT GCA GAG TCA G

22