Skip to main content

Table 1 Nucleotide sequences of specific primers and real-time PCR conditions for satellite cells

From: Early-age feed restriction affects viability and gene expression of satellite cells isolated from the gastrocnemius muscle of broiler chicks

Target genes

GenBank accession no.

Primer sequences

β-actin

GenBank NM205518

F: 5′- tgcgtgacatcaaggagaag −3′

  

R: 5′- tgccagggtacattgtggta −3′

GH-R

GenBank NM_001001293

F: 5′- aacgaggacacttacttcaccaca −3′

  

R: 5′- gcatttccatacttggggtttct −3′

IGF-IR

GenBank AJ223164

F: 5′- gcagaggagagtgaggtggaa −3′

  

R: 5′- gtaaaaggctggagatgggaga −3′

IGF-I

GenBank M32791

F: 5′- tgtgctccaataaagccacct −3′

  

R:5′- tttctgtttcctgtgttccctctac −3′

TRα

GenBank NM_205313

F: 5′-tctgcgtggataagatagagaagtg-3′

  

R: 5′- gttgtgtttgcggtagttgatgtag −3′

Bcl-2

GenBank D11381

F: 5′- gccccccgcctcaccatg −3′

  

R: 5′- cccggggtgagccatggtttc −3′

Bax

GenBank NM_007527

F: 5′- acagggtttcatccaggatcgagca-3′

  

R: 5′- tcagcttcttggtggacgcatc −3′

  1. Real-time PCR was programmed as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 94°C for 20 s, annealing at 62°C for 30 s to all the genes except 64°C for 30 s to IGF-IR, and extension and data collection at 72°C for 30 s.