Skip to main content

Table 1 Primers and regulatory element sequences used in this paper

From: Identification of an intestine-specific promoter and inducible expression of bacterial α-galactosidase in mammalian cells by a lac operon system

Name1 GenBank Primer sequenc (5’-3’) Product (bp)
HMUC2 U67167 S:5’-CTAGCTAGC TCCTCCCAGCGTAACGTGAGC-3’ 466
A:5’-GAAGATCT CTAGTGGCAGCCCCATGGTG-3’
HIFABP NG_011444 S:5’-CCGACGCGT GTTAGATTTATCTTCCCTTGACC-3’ 1154
A:5’-CCGCTCGAG TACCTTCCAAGTGCTGTCAAAC-3’
RIFABP NW_047627 S:5’-CGACGCGT CATGCTGAATTCCTTAATTTGC-3’ 1232
A:5’-CCGCTCGAG CAGCTGTGTGTGCCTCTAGG-3’
HLY NM_000239 S:5’-CTAGCTAGC CTGTCCTCTTAGGCAGATACAGA-3’ 1186
A:5’- GAAGATCT AGAGCCTTCATGTTGACTGCTA-3’
HSI X85797 S: 5’- GGGGTACC CAATGAGTGCTATCTGTGGT-3’ 230
A: 5’-CGACGCGT AAGGAAAGCTGCTTAGGTA-3’
LacI V00294 S: 5'-CCCAAGCTT CCGGAAGAGAGTCAATTCAG-3' 1143
A:5'-GCTCTAGA AGTTTCGAAGGAGAAGAAGAATCCCTGCCCGCTTTCCAGTC'-3’
GFP AY268072.1 S: 5'-CCAAGCTT TTGTTTCGTTTTCTGTTCTGCG-3' 763
A: 5'-GCTCTAGA GCAGCGTATCCACATAGCGTAA-3'
α-Gal DQ344486 S: 5’-CATGCCATGG GCGGATGGTACTCTCTTTG-3’ 2153
A: 5’-GCTCTAGA CTATTGCTTTTCCAACATCA-3’
RITF enhancer   5’-CGGGGTACCTGTTTTCCTCCCTAACCCTCTCCCCTCCCCCTCGGACTCCCACGCGTCGC-3’ 59
  1. 1HMUC2 = human mucin-2 promoter; HIFABP = human intestinal fatty acid binding protein promoter; RIFABP = rat intestinal fatty acid binding protein promoter; HLY = human lysozyme promoter; HSI= human sucrase-isomaltase enhancer; LacI = lac operon repressor; GFP = green fluorescent protein; α-Gal = α-galactosidase; RITF = rat intestinal trefoil factor.