Skip to main content

Advertisement

Table 1 Primer sequences and annealing temperatures

From: Effects of "Bioactive" amino acids leucine, glutamate, arginine and tryptophan on feed intake and mRNA expression of relative neuropeptides in broiler chicks

Gene Serial number Primer sequences (5’-3’) Annealing temp (°C) Length (bp)
β-actin NM_205518 FP: CACCGCAAATGCTTCTAAAC 58 100
RP: GCCATGCCAATCTCGTCTT
NPY NM_205473 FP: TGTTGAGGGAAAGCACAGAA 59 132
RP: GATTTGCTTCAGAGGAGTGGA
AgRP AB489993 FP: CATCCTCACCTCGGACCTCA 63 111
RP: GGGCCATCTGATCCAAGTCT
POMC NM_001031098 FP: AGAAGGGTTGGAACGAGA 61 99
RP: TACACCTTGATGGGTCTCC
MC4R NM_001031514 FP: TGGAACCAGAGCAACGGAC 62 156
RP: TGCCACAATGACCAAGACG
CRF AJ621492 FP: TCCCTGGACCTGACTTTCC 58 117
   RP: GCCTCACTTCCCGATGATTT