Skip to main content

Advertisement

Table 1 Primer and probe sequences, dual labeling (only for probes), and position in the reference sequences in real-time PCR-based assays for CVM and BLAD

From: A novel method for rapid and reliable detection of complex vertebral malformation and bovine leukocyte adhesion deficiency in Holstein cattle

Genetic defect Molecule Oligo sequence, 5′ to 3′ Reporter, 5′ Quencher, 3′ Position1
CVM      
  Primers     
   SLC35A3-FWD AGCTGGCTCACAATTTGTAGGT    9840-9861
   SLC35A3-REV CTCAAAGTAAACCCCAGCAAAGC    9896-9918
  Probes     
   SLC35A3-WD TCATGGCAGTTCTCA VIC NFQ 9863-9877
   SLC35A3-MUT TCATGGCATTTCTCA FAM NFQ 9863-9877
BLAD      
  Primers     
   CD18-FWD GTTGCGTTCAACGTGACCTT    1154-1173
   CD18-REV GAGTAGGAGAGGTCCATCAGGTA    1208-1230
  Probes     
   CD18-WD CCCCATCGACCTGTAC VIC NFQ 1192-1207
   CD18-MUT CCCATCGGCCTGTAC FAM NFQ 1193-1207
  1. 1Positions are based on the published sequences of the CD18 (GenBank Accession Number Y12672) and SLC35A3 gene (GenBank Accession Number AY160683) for BLAD and CVM, respectively.