Skip to main content

Advertisement

Table 2 Primer sequences for miRNAs used in the study

From: In ovo leptin administration affects hepatic lipid metabolism and microRNA expression in newly hatched broiler chickens

Names Primer sequences
gga-miR-15a F: 5′- TAGCAGCACATAATGGTTTGT -3′
gga-miR-15b F: 5’- TAGCAGCACATCATGGTTTGCA -3’
gga-miR-16 F:5’- TAGCAGCACGTAAATATTGGTG -3’
gga-miR-27b F:5’- TTCACAGTGGCTAAGTTCTGC -3’
gga-miR-99a F:5’- AACCCGTAGATCCGATCTTGTG -3’
gga-miR-100 F: 5′- AACCCGTAGATCCGAACTTGTG -3′
gga-miR-181a F: 5′- AACATTCAACGCTGTCGGTGAGT -3′
gga-miR-183 F: 5′- AACATTCATTGCTGTCGGTGGG -3′
gga-miR-200a F: 5′- TAACACTGTCTGGTAACGATGT -3′
gga-miR-200b F: 5′- TAATACTGCCTGGTAATGATGAT -3′
gga-miR-223 F: 5′- TGTCAGTTTGTCAAATACCCC -3′
gga-miR-429 F: 5′- TAATACTGTCTGGTAATGCCGT -3′
exogenous reference F: 5′- GTGACCCACGATGTGTATTCGC -3′
universal reverse primer F: 5′- TAGAGTGAGTGTAGCGAGCA -3′
poly(T) adapter F:5′- TAGAGTGAGTGTAGCGAGCACAGAATTAATACGACTCACTATAGG(T)16VN-3′