Skip to main content

Advertisement

Table 1 Primer sequences of chicken cathelicidins for real time PCR

From: Tissue expression and developmental regulation of chicken cathelicidin antimicrobial peptides

Gene Forward primer (5' to 3') Reverse primer (5' to 3') Product size, bp
    cDNA Gene
Fowlicidin-1 GCTGTGGACTCCTACAACCAAC GGAGTCCACGCAGGTGACATC 261 882
Fowlicidin-2 CAAGGAGAATGGGGTCATCAG CGTGGCCCCATTTATTCATTCA 221 584
Fowlicidin-3 GCTGTGGACTCCTACAACCAAC TGGCTTTGTAGAGGTTGATGC 352 1095
Cathelicidin B1 CCGTGTCCATAGAGCAGCAG AGTGCTGGTGACGTTCAGATG 170 251
GAPDH GCACGCCATCACTATCTTCC CATCCACCGTCTTCTGTGTG 356 876